 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
T.the_telo |  |
|||
| PKB-number: | PKB108 |
| Definition: | Pseudoknot of telomerase RNA of T.thermophila |
| Organism: | Tetrahymena thermophila |
| Abbreviation: | T.the_telo |
| RNA type: | Others |
| Keywords: | Ciliophora; ribonucleoprotein; telomerase |
| EMBL number: | |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] ten Dam E. et al. (1991). Nucleic Acids Res. 19:6951.
[2] Lingner J. et al. (1994). Genes & Development 8:1984-1998. [3] McCormick-Graham M. & Romero D.P. (1995). Nucleic Acids Res. 23:1091-1097. [4] Zaug A.J. & Cech T.R. (1995). RNA 1:363-374. |
| Stem sizes: Loop sizes: |
4 8 3 0 4 |
| Position Paired: | 69-72; 84-87 76-83; 92-99 |
| Bracket view of structure: |
70 80 90 100
# 6789|123456789|123456789|123456789|
$ 66 UAUAACCUUCACCAAUUAGGUUCAAAUAAGUGGUA=100
% 66 :::((((:::[[[[[[[[))))::::]]]]]]]]: