| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| BSBV2_UPD-PKc | |||||
| PKB-number: | PKB117 |
| Definition: | Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 2 |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV2_UPD-PKc |
| RNA type: | Viral 3 UTR |
| Keywords: | furovirus; pomovirus |
| EMBL number: | U64512 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 3254-3256; 3264-3266 3258-3263; 3270-3275 |
| Bracket view of structure: |
3260 3270
# 3456789|123456789|123456
$ 3253 ACGUGGGUUAUACGAUAAUAACCG=3276
% 3253 :(((:[[[[[[))):::]]]]]]: