 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BSBV2_UPD-PKb |  |
|||
| PKB-number: | PKB118 |
| Definition: | Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 2 |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV2_UPD-PKb |
| RNA type: | Viral 3 UTR |
| Keywords: | furovirus; pomovirus |
| EMBL number: | U64512 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
4 6 4 0 6 |
| Position Paired: | 3276-3279; 3290-3293 3284-3288; 3302-3306 3289-3289; 3300-3300 |
| Bracket view of structure: |
3280 3290 3300
# 56789|123456789|123456789|1234567
$ 3275 CGGUGCUUUUAUGUUCACCGAAAUCGAACAUAC=3307
% 3275 :((((::::[[[[[[))))::::::]:]]]]]: