 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BSBV3_UPD-PKc |  |
|||
| PKB-number: | PKB119 |
| Definition: | Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 3 |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV3_UPD-PKc |
| RNA type: | Viral 3 UTR |
| Keywords: | furovirus; pomovirus |
| EMBL number: | Z66493 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 2807-2809; 2817-2819 2811-2816; 2823-2828 |
| Bracket view of structure: |
2810 2820
# 6789|123456789|123456789
$ 2806 ACGUGGCGAAUACGAUAAUUCGUA=2829
% 2806 :(((:[[[[[[))):::]]]]]]: