 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BSBV3_UPD-PKb |  |
|||
| PKB-number: | PKB120 |
| Definition: | Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 3 |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV3_UPD-PKb |
| RNA type: | Viral 3 UTR |
| Keywords: | furovirus; pomovirus |
| EMBL number: | Z66493 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
6 6 1 0 9 |
| Position Paired: | 2829-2834; 2842-2847 2836-2841; 2857-2862 |
| Bracket view of structure: |
2830 2840 2850 2860
# 89|123456789|123456789|123456789|123
$ 2828 UAGUGUUCGUGGAUAACACUUUAAUUAAGAUUCAUA=2863
% 2828 :((((((:[[[[[[)))))):::::::::]]]]]]: