 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_16S-PK570/866 |  |
|||
| PKB-number: | PKB129 |
| Definition: | The pseudoknot 570-571/865-866 of 16S ribosomal RNA of E.coli |
| Organism: | E.coli |
| Abbreviation: | Ec_16S-PK570/866 |
| RNA type: | rRNA |
| Keywords: | ribosome; translation; rRNA |
| EMBL number: | E05133 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Gutell R.R. (1993). Curr. Opin. Struct. Biol. 3:313-322.
[2] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183. |
| Comment: | The pseudoknot was suggested on the basis of phylogenetic comparisons and is conserved in other 16S-like rRNAs: for review see e.g. [1]; the database of small subunit rRNAs [2]. |
| Stem sizes: Loop sizes: |
2 6 249 2 0 |
| Position Paired: | 570-571; 865-866 821-826; 874-879 829-840; 846-857 861-862; 867-868 |
| Bracket view of structure: |
570
# 89|1234 (245)
$ 568 GCGUAAA=574
% 568 ::((:::
820 830 840 850 860 870 880
#(245)|123456789|123456789|123456789|123456789|123456789|123456789|
$ 820 UGUCGACUUGGAGGUUGUGCCCUUGAGGCGUGGCUUCCGGAGCUAACGCGUUAAGUCGACC=880
% 820 :[[[[[[::((((((((((((:::::)))))))))))):::[[::))]]:::::]]]]]]: