 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TRV-PSG |  |
|||
| PKB-number: | PKB130 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA-2 of tobacco rattle virus (strain PSG) |
| Organism: | tobacco rattle virus |
| Abbreviation: | TRV-PSG |
| RNA type: | Viral tRNA-like |
| Keywords: | tobravirus; RNA 3'end |
| EMBL number: | X03686 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] van Belkum A. et al. (1987). Nucleic Acids Res.15:2837-2850.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
| Stem sizes: Loop sizes: |
3 5 3 0 3 |
| Position Paired: | 1881-1883; 1892-1894 1887-1891; 1898-1902 |
| Bracket view of structure: |
1870 1880 1890 1900
# 6789|123456789|123456789|123456789|12345
$ 1866 AGGGGUAAAACCCCUCGCCUACGUAAGCGUUAUUACGCCC=1905
% 1866 :::::::::::::::(((:::[[[[[))):::]]]]]:::