| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| NGF-H1 | |||||
| PKB-number: | PKB131 |
| Definition: | The pseudoknot of SELEX-isolated ligand H1 to human nerve growth factor |
| Organism: | |
| Abbreviation: | NGF-H1 |
| RNA type: | Aptamers |
| Keywords: | SELEX; nerve growth factor |
| EMBL number: | |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: | [1] Binkley J. et al. (1995). Nucleic Acids Res. 23:3198-3205. |
| Stem sizes: Loop sizes: |
5 6 2 0 24 |
| Position Paired: | 1-5; 14-18 8-13; 43-48 24-29; 36-41 |
| Bracket view of structure: |
10 20 30 40
# 123456789|123456789|123456789|123456789|12345678
$ 1 CGCUCAACUCAUGGAGCGCAAGACGAAUAGCUACAUAUUCGACAUGAG=48
% 1 (((((::[[[[[[))))):::::((((((::::::)))))):]]]]]]