 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CMV3 |  |
|||
| PKB-number: | PKB137 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA3 of cucumber mosaic virus |
| Organism: | cucumber mosaic virus |
| Abbreviation: | CMV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | cucumovirus; RNA 3'end; aminoacylation |
| EMBL number: | M21464 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085. [3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
| Comment: | RNAs 1 and 2 of CMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end. |
| Stem sizes: Loop sizes: |
13 5 2 1 28 |
| Position Paired: | 2066-2072; 2154-2160 2075-2080; 2089-2094 2083-2087; 2189-2193 2102-2108; 2113-2119 2122-2125; 2150-2153 2126-2132; 2139-2145 2161-2168; 2173-2180 |
| Bracket view of structure: |
2070 2080 2090 2100 2110 2120 2130
# 56789|123456789|123456789|123456789|123456789|123456789|123456789|1234
$ 2065 AGGUACCCUUGAAAUCACCUCCUAGAUUUCUUCGGAAGGGCUUCGUGAGAAGCUCGUGCACGGUAAUACA=2134
% 2065 :(((((((::((((((::[[[[[:)))))):::::::(((((((::::)))))))::(((((((((((::
2140 2150 2160 2170 2180 2190
# 56789|123456789|123456789|123456789|123456789|123456789|1234567
$ 2135 CUGAUAUUACCAAGAGUGCGGGUAUCGCCUGUGGUUUUCCACAGGUUCUCCAUAAGGAGACCA=2197
% 2135 ::::)))))))::::)))))))))))((((((((::::))))))))::::::::]]]]]::::