 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CGMMV_PKbulge |  |
|||
| PKB-number: | PKB140 |
| Definition: | tRNA-like structure bulge pseudoknot of cucumber green mottle mosaic virus |
| Organism: | cucumber green mottle mosaic virus |
| Abbreviation: | CGMMV_PKbulge |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | D12505 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Rietveld K. et al. (1984). EMBO J. 3:2613-2619.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
| Stem sizes: Loop sizes: |
8 4 4 32 7 |
| Position Paired: | 6320-6327; 6368-6375 6336-6341; 6362-6367 6343-6344; 6359-6360 6347-6349; 6355-6357 6332-6335; 6383-6386 |
| Bracket view of structure: |
6320 6330 6340 6350 6360 6370 6380
# 9|123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 6319 UUUGCUCAUUGGUUUGCGGAAACCUCUCACGUGUGACGUUGAAGUUUCUAUGGGCAGUAAUUCUGCAAG=6387
% 6319 :((((((((::::[[[[((((((:((::(((:::::))):)):)))))))))))))):::::::]]]]: