 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
ORSV-S1_PKbulge1 |  |
|||
| PKB-number: | PKB144 |
| Definition: | tRNA-like structure bulge pseudoknot of odontoglossum ringspot virus, Singapore isolate |
| Organism: | odontoglossum ringspot virus |
| Abbreviation: | ORSV-S1_PKbulge1 |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; 3'end |
| EMBL number: | U34586 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856. |
| Comment: | The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains. The UPD2 and UPD3 include bulge pseudoknot motifs, similar to this pseudoknot in the 3'-terminal tRNA-like structure. |
| Stem sizes: Loop sizes: |
8 4 4 34 7 |
| Position Paired: | 6504-6511; 6554-6561 6520-6523; 6550-6553 6529-6536; 6542-6549 6516-6519; 6569-6572 |
| Bracket view of structure: |
6510 6520 6530 6540 6550 6560 6570
# 3456789|123456789|123456789|123456789|123456789|123456789|123456789|123
$ 6503 UUGUGUAUAUGGAUCAUGCGGAUAAAGUUAUACUGGUGCAGUAUAACCCGUUAUACACAUAAAAUUAUGAG=6573
% 6503 :((((((((::::[[[[((((:::::((((((((:::::)))))))))))))))))))):::::::]]]]: