 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
ORSV-S1_PKbulge3 |  |
|||
| PKB-number: | PKB146 |
| Definition: | Bulge pseudoknot of the upstream pseudoknot domain (UPD3) of odontoglossum ringspot virus, Singapore isolate |
| Organism: | odontoglossum ringspot virus |
| Abbreviation: | ORSV-S1_PKbulge3 |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; |
| EMBL number: | U34586 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856. |
| Comment: | The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains. The UPD2 and UPD3 include bulge pseudoknot motifs similar to that in the 3'-terminal tRNA-like structure. |
| Stem sizes: Loop sizes: |
5 5 3 14 11 |
| Position Paired: | 6292-6296; 6319-6323 6305-6306; 6317-6318 6308-6310; 6314-6316 6300-6304; 6335-6339 |
| Bracket view of structure: |
6300 6310 6320 6330 6340
# 123456789|123456789|123456789|123456789|123456789|
$ 6291 UUUCACUGCGGAUAUGUAGGUUUCCUCGGUGAAUAUAAAACUUAUAUCCC=6340
% 6291 :(((((:::[[[[[((:(((:::)))))))))):::::::::::]]]]]: