 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Sc_18S-PKE21-7/8 |  |
|||
| PKB-number: | PKB147 |
| Definition: | The pseudoknot E21-7/8 of 18S ribosomal RNA of S.cerevisiae |
| Organism: | Saccharomyces cerevisiae |
| Abbreviation: | Sc_18S-PKE21-7/8 |
| RNA type: | rRNA |
| Keywords: | ribosome; rRNA |
| EMBL number: | J01353 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Neefs J.-M. & De Wachter R. (1990). Nucleic Acids Res. 18:5695-5704.
[2] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183. |
| Comment: | The pseudoknot has been suggested on the basis of phylogenetic comparisons and is conserved in eukaryotic 18S rRNAs [1]. The database of small subunit RNAs [2]. |
| Stem sizes: Loop sizes: |
10 8 3 0 7 |
| Position Paired: | 805-814; 828-837 818-819; 852-853 822-827; 845-850 |
| Bracket view of structure: |
810 820 830 840 850
# 456789|123456789|123456789|123456789|123456789|1234
$ 804 AUAAUAGAAUAGGACGUUUGGUUCUAUUUUGUUGGUUUCUAGGACCAUCGU=854
% 804 :((((((((((:::[[::[[[[[[)))))))))):::::::]]]]]]:]]: