 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BMV3_UPD-PK3 |  |
|||
| PKB-number: | PKB156 |
| Definition: | Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA3 |
| Organism: | brome mosaic virus |
| Abbreviation: | BMV3_UPD-PK3 |
| RNA type: | Viral 3 UTR |
| Keywords: | bromovirus; translational regulation; replication |
| EMBL number: | V00099 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses"
(Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
[2] Lahser F.C. et al. (1993). J. Virol. 67:3295-3303. |
| Comment: | RNAs 1 and 2 of BMV contain similar structures. Subgenomic RNA4 is derived from RNA3, with the same 3'end. |
| Stem sizes: Loop sizes: |
3 4 1 0 6 |
| Position Paired: | 1901-1903; 1909-1911 1905-1908; 1918-1921 |
| Bracket view of structure: |
1900 1910 1920
# |123456789|123456789|12
$ 1900 ACUUUGGCUAAGGUUAAAAGCUU=1922
% 1900 :(((:[[[[)))::::::]]]]: