 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BMV3_UPD-PK2 |  |
|||
| PKB-number: | PKB155 |
| Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA3 |
| Organism: | brome mosaic virus |
| Abbreviation: | BMV3_UPD-PK2 |
| RNA type: | Viral 3 UTR |
| Keywords: | bromovirus; translational regulation; replication |
| EMBL number: | V00099 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses"
(Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
[2] Lahser F.C. et al. (1993). J. Virol. 67:3295-3303. |
| Comment: | RNAs 1 and 2 of BMV contain similar structures. Subgenomic RNA4 is derived from RNA3, with the same 3'end. |
| Stem sizes: Loop sizes: |
3 5 1 0 2 |
| Position Paired: | 1865-1867; 1874-1876 1869-1873; 1879-1883 |
| Bracket view of structure: |
1870 1880
# 456789|123456789|1234
$ 1864 CCCUUGUCUCAGGUAGAGACC=1884
% 1864 :(((:[[[[[)))::]]]]]: