 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Hs_SRP-pkn |  |
|||
| PKB-number: | PKB163 |
| Definition: | The pseudoknot of signal recognition particle RNA |
| Organism: | Homo sapiens |
| Abbreviation: | Hs_SRP-pkn |
| RNA type: | Others |
| Keywords: | signal recognition particle; ribonucleoprotein; protein translocation |
| EMBL number: | V00588 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; 3D-modelling |
| References: |
[1] Zwieb C. et al. (1998). In: "Molecular Modeling of Nucleic Acids"
(Leontis N.B. & SantaLucia J., Eds.), ACS Symposium Series, v.682, American
Chemical Society, Washington DC, pp 405-413.
[2] Zwieb C.& Samuelsson T. (2000). Nucleic Acids Res. 28:171-172. (database: http://psyche.uthct.edu/dbs/SRPDB/SRPDB.html). |
| Comment: | The structure is conserved in many different SRP RNAs [1]. For the SRP database, see [2]. The numbering is shown as in [1]. |
| Stem sizes: Loop sizes: |
6 4 4 1 1 5 1 3 |
| Position Paired: | 5-10; 17-22 28-31; 40-43 12-15; 33-36 1-3; 44-46 |
| Bracket view of structure: |
10 20 30 40
# 123456789|123456789|123456789|123456789|1234567
$ 1 GCCGGGCGCGGUGGCGCGUGCCUGUAGUCCCAGCUACUCGGGAGGCU=47
% 1 (((:((((((:[[[[:)))))):::::((((:]]]]:::))))))):