 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PSLVbeta_UPD-PK2 |  |
|||
| PKB-number: | PKB166 |
| Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta |
| Organism: | poa semilatent virus |
| Abbreviation: | PSLVbeta_UPD-PK2 |
| RNA type: | Viral 3 UTR |
| Keywords: | hordeivirus |
| EMBL number: | M81486 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Solovyev A.G. et al. (1996). Virology 219:9-18. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 3382-3384; 3392-3394 3386-3391; 3398-3403 |
| Bracket view of structure: |
3390 3400
# 123456789|123456789|1234=3404
$ 3381 CGGUUUUAUCUACCAUAAGAUAAA
% 3381 :(((:[[[[[[))):::]]]]]]: