 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PSLVbeta_UPD-PK3 |  |
|||
| PKB-number: | PKB167 |
| Definition: | Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta |
| Organism: | poa semilatent virus |
| Abbreviation: | PSLVbeta_UPD-PK3 |
| RNA type: | Viral 3 UTR |
| Keywords: | hordeivirus |
| EMBL number: | M81486 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Solovyev A.G. et al. (1996). Virology 219:9-18. |
| Stem sizes: Loop sizes: |
4 8 2 0 6 |
| Position Paired: | 3404-3407; 3418-3421 3410-3416; 3430-3436 3417-3417; 3428-3428 |
| Bracket view of structure: |
3410 3420 3430
# 3456789|123456789|123456789|1234567
$ 3403 AAGUGUUUUCAUGUCCACUUAAAUCGAACAUGAAC=3437
% 3403 :((((::[[[[[[[[))))::::::]:]]]]]]]: