 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ni_VS |  |
|||
| PKB-number: | PKB178 |
| Definition: | Pseudoknot of Neurospora VS ribozyme |
| Organism: | Neurospora intermedia |
| Abbreviation: | Ni_VS |
| RNA type: | Ribozymes |
| Keywords: | Neurospora; self-cleavage; satellite RNA; mitochondrion |
| EMBL number: | M32974 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Structure probing |
| References: |
[1] Rastogi T. et al. (1996). EMBO J. 15:2820-2825.
[2] Beattie T.L. & Collins R.A. (1997). J. Mol. Biol. 267:830-840. |
| Stem sizes: Loop sizes: |
4 3 9 3 0 50 1 1 |
| Position Paired: | 623-626; 633-636 630-632; 697-699 687-695; 701-709 |
| Bracket view of structure: |
630 640
# 123456789|123456789|(45)
$ 621 AAGGGCGUCGUCGCCCCGAG=640
% 621 ::((((:::[[[))))::::
690 700 710
#(45) 6789|123456789|123456789|
$ 686 UCGUAGCAGUUGACUACUGUUAUGU=710
% 686 :(((((((((:]]]:))))))))):