 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
pMU407_repBA |  |
|||
| PKB-number: | PKB179 |
| Definition: | Pseudoknot of the regulatory region of the repBA gene |
| Organism: | plasmid pMU407.1 (IncL/M) |
| Abbreviation: | pMU407_repBA |
| RNA type: | mRNA |
| Keywords: | plasmid replication; molecular switch; translational initiation; IncL/M |
| EMBL number: | U27345 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Athanasopoulos V. et al. (1995). J. Bact. 177:4730-4741.
[2] Athanasopoulos V. et al. (1999). J. Bact. 181:1811-1819. |
| Stem sizes: Loop sizes: |
19 8 3 1 58 |
| Position Paired: | 558-567; 601-610 569-575; 593-599 577-578; 591-592 582-589; 669-676 |
| Bracket view of structure: |
560 570 580 590 600 610
# 789|123456789|123456789|123456789|123456789|123456789|1 (56)
$ 557 AACCCCCUGAUCCUAUUUCAGAACUUUGGCCGGCUCGGAAUAGAAUCAGGGGGUG=611
% 557 :((((((((((:(((((((:((:::[[[[[[[[:))))))))):)))))))))):
670 680
# 89|123456789|
$ 668 CCCGGCCAAUAUG=680
% 668 :]]]]]]]]::::