 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
pMU720_repBA |  |
|||
| PKB-number: | PKB180 |
| Definition: | Pseudoknot of the regulatory region of the repBA gene |
| Organism: | plasmid pMU720 (IncB) |
| Abbreviation: | pMU720_repBA |
| RNA type: | mRNA |
| Keywords: | plasmid replication; molecular switch; translational initiation; IncB |
| EMBL number: | M28718 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Praszkier J. et al. (1992). J. Bact. 174:2376-2383.
[2] Wilson I.W. et al. (1997). J. Bact. 179:742-753. |
| Stem sizes: Loop sizes: |
16 7 4 1 83 |
| Position Paired: | 569-574; 613-618 576-583; 604-611 586-587; 600-601 592-598; 702-708 |
| Bracket view of structure: |
570 580 590 600 610 620
# 89|123456789|123456789|123456789|123456789|123456789| (79)
$ 568 ACCCCCACUAUUUUUCCUCGAACUUGGCGGAACGCAGAAAAAUAAUGGGGGCC=620
% 568 :((((((:((((((((::((::::[[[[[[[:))::)))))))):))))))::
700 710
# 700 |123456789|
$ 700 GCUCCGCCAUA=710
% ::]]]]]]]::