| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| HCV_IRES | |||||
| PKB-number: | PKB181 |
| Definition: | domain IIIef of IRES RNA |
| Organism: | hepatitis C virus |
| Abbreviation: | HCV_IRES |
| RNA type: | Viral 5 UTR |
| Keywords: | flaviviridae; internal ribosomal entry site; translation |
| EMBL number: | M62321 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing; small-angle X-ray scattering (SAXS) |
| References: |
[1] Brown E.A. et al. (1992). Nucleic Acids Res. 20:5041-5045.
[2] Kieft J.S. et al. (1999). J. Mol. Biol. 292:513-529. |
| Stem sizes: Loop sizes: |
11 6 1 1 1 |
| Position Paired: | 125-133; 315-323 134-135; 289-290 291-293; 300-302 303-304; 313-314 306-311; 325-330 |
| Bracket view of structure: |
130
# 56789|123456(151)
$ 125 CCUCCCGGGAGA=136
% 125 (((((((((((:
290 300 310 320 330
#(151)89|123456789|123456789|123456789|123456789|1
$ 288 ACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAG=331
% 288 :))(((::::::)))((:[[[[[[:))))))))))):]]]]]]: