 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SBRMV1-PKa |  |
|||
| PKB-number: | PKB182 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA1 |
| Organism: | soil-borne rye mosaic virus |
| Abbreviation: | SBRMV1-PKa |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end |
| EMBL number: | AF146278 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140. |
| Stem sizes: Loop sizes: |
3 5 4 0 3 |
| Position Paired: | 7000-7002; 7012-7014 7007-7011; 7018-7022 |
| Bracket view of structure: |
6990 7000 7010 7020
# 56789|123456789|123456789|123456789|123456
$ 6985 GGGGUUCAAAUCCCCCCCCGAACCGGAGGGUUAUCCGGCCCA=7026
% 6985 :::::::::::::::(((::::[[[[[))):::]]]]]::::