 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Pp_18S-PKE23-9/12 |  |
|||
| PKB-number: | PKB205 |
| Definition: | Pseudoknot E23-9/12 of 18S ribosomal RNA |
| Organism: | Palmaria palmata |
| Abbreviation: | Pp_18S-PKE23-9/12 |
| RNA type: | rRNA |
| Keywords: | ribosome; rRNA; Rhodophyta |
| EMBL number: | X53500 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Wuyts J. et al. (2000). Nucleic Acids Res. 28:4698-4708.
[2] Van de Peer Y. et al. (2000). Nucleic Acids res. 28:175-176. (database: http://rrna.uia.ac.be/ssu/). |
| Comment: | The pseudoknot has been suggested on the basis of phylogenetic comparison and is conserved in eukaryotic 18S rRNAs [1]. The database of small subunit rRNAs [2]. The nucleotide C747 is missing in the structure shown in [1]. |
| Stem sizes: Loop sizes: |
4 4 1 2 8 |
| Position Paired: | 732-733; 764-765 736-737; 745-746 747-748; 760-761 749-751; 756-758 739-742; 774-777 |
| Bracket view of structure: |
740 750 760 770
# 123456789|123456789|123456789|123456789|12345678
$ 731 UUAGAGUGUUCAAAGCCAGGCGUUUGCCGUGAAUACAUUAGCAUGGAA=778
% 731 :((::((:[[[[::))(((((::::))):))::))::::::::]]]]: