 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Hs_PrP |  |
|||
| PKB-number: | PKB206 |
| Definition: | Pseudoknot in the PrP-encoding mRNA |
| Organism: | Homo sapiens |
| Abbreviation: | Hs_PrP |
| RNA type: | mRNA |
| Keywords: | prion; Creutzfeldt-Jacob disease (CJD); Bovine spongiform encephalopathy (BSE) |
| EMBL number: | M13899 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; 3D-modelling |
| References: |
[1] Wills P.R. (1992). J. Theor. Biol. 159:523-527.
[2] Barrette I., Poisson G., Gendron P. & Major F. (2001). Nucleic Acids Res. 29:753-758. |
| Comment: | This region of the prion-encoding mRNA contains several sequence repeats with possible similar pseudoknot structures. Homologous pseudoknots have been suggested for some other PrP mRNAs [2]. |
| Stem sizes: Loop sizes: |
6 5 13 0 4 |
| Position Paired: | 229-234; 253-258 248-252; 263-267 |
| Bracket view of structure: |
230 240 250 260 270
# 6789|123456789|123456789|123456789|123456789|
$ 226 GCCUCAUGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGG=270
% 226 :::((((((:::::::::::::[[[[[))))))::::]]]]]:::