 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Vp_PK2 |  |
|||
| PKB-number: | PKB234 |
| Definition: | Pseudoknot PK2 of Variovorax paradoxus tmRNA |
| Organism: | Variovorax paradoxus |
| Abbreviation: | Vp_PK2 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA; beta-proteobacteria |
| EMBL number: | |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Sequence comparison; 3D-modeling |
| References: |
[1] Felden B., Massire C., Westhof E., Atkins J.F. & Gesteland R.F. (2001). Nucleic Acids Res. 29:1602-1607.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmRNA). [3] Knudsen B., Wower J., Zwieb C., & Gorodkin J. (2001). Nucleic Acids Res. 29:171-172. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/). |
| Comment: | This type of the PK2 pseudoknot structure is conserved in tmRNAs from the beta-proteobacteria [1]. |
| Stem sizes: Loop sizes: |
9 7 3 2 7 |
| Position Paired: | 136-141; 198-203 144-146; 159-161 150-156; 211-217 163-177; 182-196 |
| Bracket view of structure: |
140 150 160 170 180 190 200
# 56789|123456789|123456789|123456789|123456789|123456789|123456789|1234
$ 135 GCCUUGCAACAGUUGGCCGAUGGGCUGGGCAAGGGGGUCUGGAGCAAUCCUGACCUCCCGGCUGCAAGGA=204
% 135 :((((((::(((:::[[[[[[[::))):(((((((((((((((::::))))))))))))))):)))))):
210
# 56789|12345678
$ 205 UAACUACAUGGGCU=218
% 205 ::::::]]]]]]]: