 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
GLV_IRES |  |
|||
| PKB-number: | PKB235 |
| Definition: | Pseudoknot in the putative downstream IRES of Giardiaviral transcript |
| Organism: | Giardiavirus |
| Abbreviation: | GLV_IRES |
| RNA type: | Viral others |
| Keywords: | Giardiavirus; Capsid coding region; IRES |
| EMBL number: | L13218 |
| Submitted by: | Srinivas Garlapati and Ching C. Wang ( srini@itsa.ucsf.edu) |
| Supported by: | Mutagenesis; Structure probing |
| References: | [1] Garlapati S. & Wang C.C. (2002). RNA 8:601-611. |
| Comment: | |
| Stem sizes: Loop sizes: |
6 5 4 0 51 |
| Position Paired: | 144-149; 159-164 154-158; 216-220 166-170; 178-182 193-199; 209-215 |
| Bracket view of structure: |
150 160 170 180 190 200
# 456789|123456789|123456789|123456789|123456789|123456789|
$ 144 GGAGACCCAUGGAGAGUCUCCAGAGGUUCCUAAGGCCUCGAUCGCGCCUGCCGGGAG=200
% 144 ((((((::::[[[[[)))))):(((((:::::::)))))::::::::::(((((((:
210 220
# 123456789|123456789|
$ 201 GCAGAAUGUCCCGGUUCUCC=220
% 201 ::::::::)))))))]]]]]