 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
IFNG_PK |  |
|||
| PKB-number: | PKB236 |
| Definition: | regulatory pseudoknot of the interferon-gamma gene 5'-UTR |
| Organism: | Homo sapiens |
| Abbreviation: | IFNG_PK |
| RNA type: | mRNA |
| Keywords: | translation; PKR |
| EMBL number: | J00219 |
| Submitted by: | Raymond Kaempfer ( kaempfer@huji.ac.il) |
| Supported by: | Mutagenesis; Structure probing |
| References: | [1] Ben-Asouli Y., Banai Y., Pel-Or Y., Shir A. & Kaempfer R. (2002). Cell 108:221-232. |
| Comment: | |
| Stem sizes: Loop sizes: |
7 33 0 4 7 |
| Position Paired: | 8-14; 64-70 15-19; 116-120 20-22; 112-114 25-29; 103-107 32-36; 97-101 41-48; 86-93 51-53; 83-85 56-59; 78-81 |
| Bracket view of structure: |
10 20 30 40 50 60
# 123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 CAUUGUUCUGAUCAUCUGAAGAUCAGCUAUUAGAAGAGAAAGAUCAGUUAAGUCCUUUGG=60
% 1 :::::::((((((([[[[[[[[::[[[[[::[[[[[::::[[[[[[[[::[[[::[[[[:
70 80 90 100 110 120
# 123456789|123456789|123456789|123456789|123456789|123456789|
$ 61 ACCUGAUCAGCUUGAUACAAGAACUACUGAUUUCAACUUCUUUGGCUUAAUUCUCUCGGA=120
% 61 :::))))))):::::::]]]]:]]]]]]]]]]]:::]]]]]:]]]]]::::]]]:]]]]]