 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
hTER |  |
|||
| PKB-number: | PKB243 |
| Definition: | human telomerase RNA pseudoknot |
| Organism: | Homo sapiens |
| Abbreviation: | hTER |
| RNA type: | Others |
| Keywords: | ribonucleoprotein; telomerase |
| EMBL number: | AF221907 |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Mutagenesis; NMR; Sequence comparison; |
| References: |
[1] Chen J.L. et al. (2000). Cell 100:503-514.
[2] Theimer C.A. et al. (2003). PNAS 100:449-454. [3] Ly H. et al. (2003). Genes & Development 17:1078-1083. |
| Comment: | The pseudoknot is conserved in the vertebrate telomerase RNAs [1]. The conformational transitions of this pseudoknot structure to the hairpin conformation [2] and to the dimeric \"trans-pseudoknot\" [3] have been proposed. |
| Stem sizes: Loop sizes: |
22 9 8 0 29 |
| Position Paired: | 65-67; 142-144 68-72; 136-140 78-82; 127-131 90-98; 116-124 107-112; 178-183 113-115; 174-176 |
| Bracket view of structure: |
70 80 90 100 110 120
# 456789|123456789|123456789|123456789|123456789|123456789|12345
$ 64 GGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGG=125
% 64 :((((((((:::::(((((:::::::(((((((((::::::::[[[[[[[[[))))))))):
130 140 150 160 170 180
# 6789|123456789|123456789|123456789|123456789|123456789|1234
$ 126 AAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCU=184
% 126 :)))))::::))))):))):::::::::::::::::::::::::::::]]]:]]]]]]: