 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BCV |  |
|||
| PKB-number: | PKB256 |
| Definition: | 3'UTR pseudoknot of bovine coronavirus |
| Organism: | bovine coronavirus |
| Abbreviation: | BCV |
| RNA type: | Viral 3 UTR |
| Keywords: | Coronaviridae; |
| EMBL number: | DQ811784 |
| Submitted by: | A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing; |
| References: | [1] Williams G.D. et al. (1999). J. Virol. 73:8349-8355. |
| Comment: | |
| Stem sizes: Loop sizes: |
8 10 15 1 2 |
| Position Paired: | 30803-30810; 30837-30844 30826-30835; 30847-30856 |
| Bracket view of structure: |
30810 30820 30830 30840 30850
# 23456789|123456789|123456789|123456789|123456789|1234567
$ 30802 CUCUCUAUCAGAAUGGAUGUCUUGCUGCUAUAAUAGAUAGAGAAGGUUAUAGCAGA=30857
% 30802 :((((((((:::::::::::::::[[[[[[[[[[:))))))))::]]]]]]]]]]: