 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
MHV |  |
|||
| PKB-number: | PKB255 |
| Definition: | 3'UTR pseudoknot of mouse hepatitis virus |
| Organism: | mouse hepatitis virus |
| Abbreviation: | MHV |
| RNA type: | Viral 3 UTR |
| Keywords: | Coronaviridae; |
| EMBL number: | AY700211 |
| Submitted by: | A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; |
| References: | [1] Goebel S.J. et al. (2004). J. Virol. 78:669-682. |
| Comment: | |
| Stem sizes: Loop sizes: |
8 10 15 1 2 |
| Position Paired: | 31098-31105; 31132-31139 31121-31130; 31142-31151 |
| Bracket view of structure: |
31100 31110 31120 31130 31140 31150
# 789|123456789|123456789|123456789|123456789|123456789|12
$ 31097 CUCUCUAUCAGAAUGGAUGUCUUGCUGUCAUAACAGAUAGAGAAGGUUGUGGCAGA=31152
% 31097 :((((((((:::::::::::::::[[[[[[[[[[:))))))))::]]]]]]]]]]: