 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SBU |
 |
|||
| PKB-number: | PKB304 |
| Definition: | PreQ1 riboswitch |
| Organism: | B. subtilis |
| Abbreviation: | SBU |
| RNA type: | Aptamers |
| Keywords: | preQ1, riboswitch, 7-aminomethyl-7-deazaguanine |
| EMBL number: | |
| Submitted by: | Thomas Edwards (tedwards@decode.com) |
| Supported by: | Crystal structure,Sequence comparison,Structure probing |
| References: |
[1] Roth, A. et al., Nat. Struct. Mol. Biol. 14, 308-317, 2007.
[2] Klein, D.J. et al., Nat. Struct. Mol. Biol. 16, 343-344, 2009. |
| Comment: | This is currently the smallest known riboswitch (mRNA genetic control element) with only 34 nts. It responds to preQ1 (7-aminomethyl-7-deazaguanine) to form an H-type pseudoknot with preQ1 binding to the core. It is noteworth in that it contains a 6 nt L2 yet retains colinear helical stacking of S1 and S2. |
| Stem sizes: Loop sizes: |
5 3 3 6 8 |
| Position Paired: | 1 -5 ; 18-22 |
| Bracket view of structure: |
10 20 30
# 123456789|123456789|123456789|1234
$ 1 AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA=34
% 1 (((((:::[[[::::::)))))::::::::]]]: