Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBU

PKB-number: PKB304
Definition: PreQ1 riboswitch
Organism: B. subtilis
Abbreviation: SBU
RNA type: Aptamers
Keywords: preQ1, riboswitch, 7-aminomethyl-7-deazaguanine
EMBL number:
Submitted by: Thomas Edwards (tedwards@decode.com)
Supported by: Crystal structure,Sequence comparison,Structure probing
References: [1] Roth, A. et al., Nat. Struct. Mol. Biol. 14, 308-317, 2007.
[2] Klein, D.J. et al., Nat. Struct. Mol. Biol. 16, 343-344, 2009.
Comment: This is currently the smallest known riboswitch (mRNA genetic control element) with only 34 nts. It responds to preQ1 (7-aminomethyl-7-deazaguanine) to form an H-type pseudoknot with preQ1 binding to the core. It is noteworth in that it contains a 6 nt L2 yet retains colinear helical stacking of S1 and S2.
Stem sizes:
Loop sizes:
5 3
3 6 8
Position Paired:
1 -5 ; 18-22
9 -11; 31-33
Bracket view of structure:
            10        20        30
#   123456789|123456789|123456789|1234
$ 1 AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA=34
% 1 (((((:::[[[::::::)))))::::::::]]]:


Home
Visits
Visiters
© Eke van Batenburg