 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SAH_riboswitch |
 |
|||
| PKB-number: | PKB343 |
| Definition: | SAH riboswitch aptamer domain |
| Organism: | Ralstonia solanacearum |
| Abbreviation: | SAH_riboswitch |
| RNA type: | Aptamers |
| Keywords: | SAH; riboswitch; S-adenosyl-(L)-homocysteine |
| EMBL number: | 3NPQ |
| Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
| Supported by: | Crystal structure,Sequence comparison |
| References: |
[1] Wang JX et al. (2008). Mol. Cell 29:691-702.
[2] Edwards AL et al. (2010). RNA 16:2144-2155. |
| Comment: | A representative structure of the SAH class of riboswitches. For simplicity, some of tertiary base interactions [1] are not shown here. |
| Stem sizes: Loop sizes: |
7 6 0 18 9 |
| Position Paired: | 1 -7 ; 32-38 |
| Bracket view of structure: |
10 20 30 40 50
# 123456789|123456789|123456789|123456789|123456789|1234
$ 1 GGACGAGGAGCGCUGCAAGCGAGAGCCCAGGCUCGUCCGUUCAAACGGCGCUCA=54
% 1 ((((((([[[[[[:::::((::::)):::::))))))):::::::::]]]]]]: