|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
SAM-I_riboswitch |
|
|||
| PKB-number: | PKB344 |
| Definition: | SAM-I riboswitch aptamer domain |
| Organism: | Thermoanaerobacter tengcongensis |
| Abbreviation: | SAM-I_riboswitch |
| RNA type: | Aptamers |
| Keywords: | SAM; riboswitch; S-adenosylmethionine |
| EMBL number: | 2GIS |
| Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
| Supported by: | Crystal structure,Mutagenesis,Sequence comparison,Structure probing |
| References: |
[1] Montange RK & Batey RT (2006). Nature 441:1172-1175.
[2] Lu C et al. (2010). J. Mol. Biol. 404:803-818. [3] Hennelly SP & Sanbonmatsu KY (2011). Nucleic Acids Res. 39:2416-2431. |
| Comment: | A representative structure of the SAM-I class of riboswitches. |
| Stem sizes: Loop sizes: |
10 4 1 1 0 22 0 16 |
| Position Paired: | 1 -8 ; 86-93 |
| Bracket view of structure: |
10 20 30 40 50
# 123456789|123456789|123456789|123456789|123456789|
$ 1 GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCAG=50
% 1 ((((((((::::(:(((((((((:[[[[))):::)))))))(((::(((:
60 70 80 90
# 123456789|123456789|123456789|123456789|1234
$ 51 AAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCA=94
% 51 :::))):))):::(]]]](((((::::)))))::))))))))):