 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
KUNV |
 |
|||
| PKB-number: | PKB346 |
| Definition: | NS1' ribosomal frameshift site of West Nile virus |
| Organism: | West Nile virus, Kunijn subtype |
| Abbreviation: | KUNV |
| RNA type: | Viral Frameshift |
| Keywords: | Flaviviridae; ribosomal frameshifting |
| EMBL number: | AY274504 |
| Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison |
| References: |
[1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647. |
| Comment: | |
| Stem sizes: Loop sizes: |
11 7 6 3 17 |
| Position Paired: | 3558-3568; 3585-3595 |
| Bracket view of structure: |
3550 3560 3570 3580 3590 3600
# 6789|123456789|123456789|123456789|123456789|123456789|
$ 3546 UCCUUUUCAGCUGGGCCUUCUGGUCGUGUUCUUGGCCACCCAGGAGGUCCUUCGC=3600
% 3546 ::::::::::::(((((((((((::::::[[[[[[[:::))))))))))):((::
3610 3620
# 123456789|123456789|
$ 3601 AAGAGGUGGACAGCCAAGAU=3620
% 3601 ::))::::::::]]]]]]]: