 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
MIDV |
 |
|||
| PKB-number: | PKB352 |
| Definition: | 6K/TF ribosomal frameshift site of Middelburg virus |
| Organism: | Middelburg virus |
| Abbreviation: | MIDV |
| RNA type: | Viral Frameshift |
| Keywords: | Togaviridae; Alphavirus; ribosomal frameshifting |
| EMBL number: | AF339486 |
| Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison |
| References: |
[1] Firth AE et al. (2008) Virol. J. 5:108.
[2] Chung BYW et al. (2010). J. Mol. Biol 397:448-456. |
| Stem sizes: Loop sizes: |
10 7 3 1 13 |
| Position Paired: | 3047-3049; 3077-3079 |
| Bracket view of structure: |
3040 3050 3060 3070 3080 3090 3100
# 123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 3031 UUCUUUUUUAGUGGCAGUAAGCCUGGGAAUGGGGGCGACCCAGGCGUAUGAACAUAGUGUAACGCUCCCC=3100
% 3031 ::::::::::::::::(((:(((((((:::[[[[[[[:))))))):))):::::::::::::]]]]]]]: