 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SESV |
 |
|||
| PKB-number: | PKB353 |
| Definition: | 6K/TF ribosomal frameshift site of Seal louse virus |
| Organism: | Seal louse virus |
| Abbreviation: | SESV |
| RNA type: | Viral Frameshift |
| Keywords: | Togaviridae; Alphavirus; ribosomal frameshifting |
| EMBL number: | AF315122 |
| Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison |
| References: |
[1] Firth AE et al. (2008) Virol. J. 5:108.
[2] Chung BYW et al. (2010). J. Mol. Biol 397:448-456. |
| Stem sizes: Loop sizes: |
11 8 1 0 9 |
| Position Paired: | 1709-1719; 1729-1739 |
| Bracket view of structure: |
1700 1710 1720 1730 1740 1750 1760
# 123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1691 UUUGUUUUUUAGCUGUGCUGGGUGCGAGUGUGGCAGCGGCUCGUGCCUACGAACACACCGCUGUCAUGCC=1760
% 1691 ::::::::::::::::::(((((((((((:[[[[[[[[))))))))))):::::::::]]]]]]]]::::