|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
PMoV3 |
|
|||
| PKB-number: | PKB385 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | Parietaria mottle virus |
| Abbreviation: | PMoV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_005854 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
17 7 2 1 45 |
| Position Paired: | 2167-2175; 2207-2215 |
| Bracket view of structure: |
2170 2180 2190 2200 2210 2220 2230 # 6789|123456789|123456789|123456789|123456789|123456789|123456789| $ 2166 GGAUGUUCGGGUGGCUGCUUAAGCGCUUCUAUACUUAAGUACCGAAUGUUAUACCGUUAUUAUCU=2230 % 2166 :(((((((((:::::((((((((::[[[[[[[:)))))))))))))))))::::((((((((((: 2240 2250 2260 # 123456789|123456789|123456789|12345678 $ 2231 AGUGAUAAUAACGAUGCCUAUUUCUAUGAAAUAGAAGC=2268 % 2231 :::)))))))))):::::::::::::::::]]]]]]]: