|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
TAMV1 |
|
|||
| PKB-number: | PKB386 |
| Definition: | tRNA-like structure pseudoknot of RNA1 |
| Organism: | Tulare apple mosaic virus |
| Abbreviation: | TAMV1 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_003833 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
15 5 7 0 65 |
| Position Paired: | 3332-3338; 3380-3386 |
| Bracket view of structure: |
3340 3350 3360 3370 3380 3390 3400 # 123456789|123456789|123456789|123456789|123456789|123456789|123456789| $ 3331 AGUUCAUAUGCCCACCUUUGCUUGUCUCCGGGUGGAUGCCUCAUGGUGCUAUGAAUGCCUAUAAUUGAAA=3400 % 3331 :(((((((:((((((((:::::::[[[[[))))))::::::::::::)))))))))::(((((((::::: 3410 3420 3430 3440 3450 # 123456789|123456789|123456789|123456789|123456789|123456789 $ 3401 UAUUAUAGAUGCCUAAUUUUCCUCUCUUGAGGAAAAUUAGAUGCCUCCAAGGGAGAAGC=3459 % 3401 :)))))))::::((((((((((((::::)))))))))))):::::::::::]]]]]:::