|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
AV-2_3 |
|
|||
| PKB-number: | PKB390 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | Asparagus virus 2 |
| Abbreviation: | AV-2_3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_011807 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
13 4 6 0 67 |
| Position Paired: | 2179-2185; 2225-2231 |
| Bracket view of structure: |
2180 2190 2200 2210 2220 2230 2240 # 89|123456789|123456789|123456789|123456789|123456789|123456789| $ 2178 AGUCCAUAUGCCCAUCUUUGCUGCUCCGGAUGGAUGUUUAUACCCGCUAUGGAUGCCUAUUAC=2240 % 2178 :(((((((:::((((((::::::[[[[))))))::::::::::::::)))))))::((((((( 2250 2260 2270 2280 2290 2300 # 123456789|123456789|123456789|123456789|123456789|123456789|123 $ 2241 UGAAAUGUAAUAGAUGCCUAAUACUCUCUCUCAGGGAGAGAGUUUAGAUGCCUCCAAAGGAGA=2303 % 2241 ::::::)))))))::::((((:((((((((:::::)))))))))))):::::::::::]]]]: # 4567 $ 2304 UGCU=2307 % 2304 ::::