|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
EMoV3 |
|
|||
| PKB-number: | PKB391 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | Elm mottle virus |
| Abbreviation: | EMoV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_003570 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
13 4 6 0 66 |
| Position Paired: | 2189-2195; 2235-2241 |
| Bracket view of structure: |
2190 2200 2210 2220 2230 2240 2250 2260 # 89|123456789|123456789|123456789|123456789|123456789|123456789|123456789| $ 2188 AGUCCAUAUGCCCAUCUUUGCUGCUCCGGAUGGAUGUUAAUACCCCCUAUGGAUGCCUAUUAUUGAAAAAUAA=2260 % 2188 :(((((((:::((((((::::::[[[[))))))::::::::::::::)))))))::((((((((::::))))) 2270 2280 2290 2300 2310 # 123456789|123456789|123456789|123456789|123456789|12345 $ 2261 UAGAUGCCUAAUUCUCUCUCUCAGGGAGAGAGAUUAGAUGCCUCCAAGGAGAUGC=2315 % 2261 )))::::((((:((((((((:::::))))))))))))::::::::::]]]]::::