|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
APLPV3 |
|
|||
| PKB-number: | PKB393 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | American plum line pattern virus |
| Abbreviation: | APLPV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_003453 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
14 5 2 1 56 |
| Position Paired: | 1949-1955; 1983-1989 |
| Bracket view of structure: |
1950 1960 1970 1980 1990 2000 2010 # 89|123456789|123456789|123456789|123456789|123456789|123456789| $ 1948 AGUUAACUACGAUGUCGGCCCUAGGACAUCUAUCGAGUUAACGACGAUCGCUUUGCGAUUAUG=2010 % 1948 :(((((((:(((((((::[[[[[:))))))::::)))))))):::((((((:::))))))::: 2020 2030 2040 2050 # 123456789|123456789|123456789|123456789|123 $ 2011 CUUCAUUUUUUCUUUCGAAAAAAUGAAAUGACCCUUAGGGGCC=2053 % 2011 :(((((((((((::::)))))))))))::::::::]]]]]:::