|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
HJLV3 |
|
|||
| PKB-number: | PKB394 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | Humulus japonicus latent virus |
| Abbreviation: | HJLV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_006066 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
14 4 4 0 51 |
| Position Paired: | 1837-1841; 1875-1879 |
| Bracket view of structure: |
1840 1850 1860 1870 1880 1890 # 6789|123456789|123456789|123456789|123456789|123456789| $ 1836 AGACAUAUAUGCCUAUUGCCCCCUGUAGGAGUGCACUAGAUGUUGCGUGAAGAUA=1890 % 1836 :(((((:(((((((((::::[[[[)))))::::)):)):)))))::(((((((:: 1900 1910 1920 1930 # 123456789|123456789|123456789|123456789|12345678 $ 1891 UUUCUUCAUUUGCCCUACCAAAAGGUAGGAUGCCCCUUUAAGGGAGGC=1938 % 1891 ::)))))))::::((((((::::)))))):::::::::::]]]]::::