|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
PNRSV3 |
|
|||
| PKB-number: | PKB396 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | Prunus necrotic ringspot virus |
| Abbreviation: | PNRSV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_004364 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison,circular dichroism |
| References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Aparicio F. et al. (2003). Virology 313:213-223. [3] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
15 6 1 0 49 |
| Position Paired: | 1859-1865; 1895-1901 |
| Bracket view of structure: |
1860 1870 1880 1890 1900 1910 1920 # 89|123456789|123456789|123456789|123456789|123456789|123456789| $ 1858 UAGAUUUCUGAAAGUCGCUUCCCGGCUUUCAUGCUUGGAAAUCUUACCUGCGUUAGCAGAUGC=1920 % 1858 :(((((((((((((((:[[[[[[))))))))::::::))))))):::((((::::)))):::: 1930 1940 1950 # 123456789|123456789|123456789|1234567 $ 1921 CCACAACGUGAAGUUGUGGAUGCCCCGUUAGGGAAGC=1957 % 1921 (((((((:::::))))))):::::::::::]]]]]]: