 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PMMV-S_UPD-PK2 |  |
|||
| PKB-number: | PKB96 |
| Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'-UTR of pepper mild mottle virus, Spanish isolate |
| Organism: | pepper mild mottle virus |
| Abbreviation: | PMMV-S_UPD-PK2 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | M81413 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Avila-Rincon M.J. et al. (1989). J. Gen. Virol. 70:3025-3031.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 6198-6200; 6208-6210 6202-6207; 6214-6219 |
| Bracket view of structure: |
6200 6210 6220
# 789|123456789|123456789|
$ 6197 CCGUGGCGAGUACGAUAACUCGUA=6220
% 6197 :(((:[[[[[[))):::]]]]]]: