 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
satRPV |  |
|||
| PKB-number: | PKB173 |
| Definition: | Attenuator pseudoknot of the hammerhead ribozyme |
| Organism: | Satellite cereal yellow dwarf virus-RPV RNA |
| Abbreviation: | satRPV |
| RNA type: | Ribozymes |
| Keywords: | satellite RNA; kissing interaction; molecular switch |
| EMBL number: | M63666 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis |
| References: |
[1] Miller W.A & Silver S.L. (1991). Nucleic Acids Res. 19:5313-5320.
[2] Song S.I. et al. (1999). J. Mol. Biol. 293:781-793. |
| Comment: | The "kissing" interaction (6-10/30-34) inhibits self-cleavage in monomeric satRPV RNA, but is required in multimers for efficient replication by a rolling circle mechanism [1,2]. SatRPV RNA was previously called satellite RNA of barley yellow dwarf virus (sBYDV). |
| Stem sizes: Loop sizes: |
4 5 5 1 2 8 0 33 |
| Position Paired: | 1-4; 13-16 25-29; 68-72 35-38; 56-59 43-46; 51-54 6-10; 30-34 |
| Bracket view of structure: |
10 20 30 40 50 60
# 123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 ACAGAGCGCGUACUGUCUGACGACGUAUCCGCGCGGACUAGAAGGCUGGUGCCUCGUCCA=60
% 1 ((((:[[[[[::))))::::::::(((((]]]]]((((::::((((::::)))):)))):
70
# 123456789|123
$ 61 ACAAAUAGAUACA=73
% 61 :::::::))))):