 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
WBV |  |
|||
| PKB-number: | PKB253 |
| Definition: | ORF1a/1b ribosomal frameshift site of White Bream Virus |
| Organism: | White Bream Virus |
| Abbreviation: | WBV |
| RNA type: | Viral Frameshift |
| Keywords: | Nidovirales; ribosomal frameshifting |
| EMBL number: | NC_008516 |
| Submitted by: | A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl) |
| Supported by: | Sequence comparison; |
| References: | [1] Schutze H. et al. (2006). J. Virol. 80:11598-11609. |
| Comment: | |
| Stem sizes: Loop sizes: |
14 5 3 0 29 |
| Position Paired: | 14560-14573; 14582-14595 14577-14581; 14625-14629 |
| Bracket view of structure: |
14550 14560 14570 14580 14590 14600
# 9|123456789|123456789|123456789|123456789|123456789|
$ 14549 UUUAAACUGGUGGGGCAGUGUCUAGGAUUGACGUUAGACACUGCUUUUUGCC=14600
% 14549 :::::::::::((((((((((((((:::[[[[[)))))))))))))):::::
14610 14620 14630
# 123456789|123456789|123456789|
$ 14601 CGUUUCAAACAGGUGAAUACAAACCGUCAU=14630
% 14601 ::::::::::::::::::::::::]]]]]: