Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PLRV-W

PKB-number: PKB42
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of potato leafroll virus, Wageningen isolate
Organism: potato leafroll virus
Abbreviation: PLRV-W
RNA type: Viral Frameshift
Keywords: luteovirus; ribosomal frameshifting; RNA polymerase
EMBL number: Y07496
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van der Wilk F. et al. FEBS Lett. 1989, 245:51-56.
[2] ten Dam E.B. et al. Virus Genes 1990, 4:121-136.
Stem sizes:
Loop sizes:
4 3
2 1 9
Position Paired:
1676-1679; 1686-1689
1682-1684; 1699-1701
Bracket view of structure:
                1670      1680      1690      1700
     #      3456789|123456789|123456789|123456789|1
     $ 1663 UUUAAAUGGGCGAGCGGCACCGCCCGCCAAAACAAACGG=1701
     % 1663 :::::::::::::((((::[[[:)))):::::::::]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-20 PKB00042.html