Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PLRV-S

PKB-number: PKB43
Definition: ORF2a/ORF2b (putative RNA-dependent RNA polymerase) ribosomal frameshift site of potato leafroll virus, Scottish isolate
Organism: potato leafroll virus
Abbreviation: PLRV-S
RNA type: Viral Frameshift
Keywords: luteovirus; ribosomal frameshifting; RNA polymerase
EMBL number: D00530
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Mayo MA et al. J.Gen.Virol. 1989, 70:1037-1051.
[2] ten Dam EB et al. Virus Genes 1990, 4:121-136.
[3] Kujawa AB et al. Nucleic Acids Res. 1993, 21:2165-2171.
Stem sizes:
Loop sizes:
4 4
2 0 8
Position Paired:
1781-1784; 1791-1794
1787-1790; 1803-1806
Bracket view of structure:
           1770      1780      1790      1800
     #      89|123456789|123456789|123456789|123456
     $ 1768 UUUAAAUGGGCAAGCGGCACCGUCCGCCAAAACAAACGG=1806
     % 1768 :::::::::::::((((::[[[[))))::::::::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-4-20 PKB00043.html