Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
PLRV-S |
PKB-number: | PKB43 |
Definition: | ORF2a/ORF2b (putative RNA-dependent RNA polymerase) ribosomal frameshift site of potato leafroll virus, Scottish isolate |
Organism: | potato leafroll virus |
Abbreviation: | PLRV-S |
RNA type: | Viral Frameshift |
Keywords: | luteovirus; ribosomal frameshifting; RNA polymerase |
EMBL number: | D00530 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Mutagenesis; Sequence comparison |
References: |
[1] Mayo MA et al. J.Gen.Virol. 1989, 70:1037-1051.
[2] ten Dam EB et al. Virus Genes 1990, 4:121-136. [3] Kujawa AB et al. Nucleic Acids Res. 1993, 21:2165-2171. |
Stem sizes: Loop sizes: |
4 4 2 0 8 |
Position Paired: | 1781-1784; 1791-1794 1787-1790; 1803-1806 |
Bracket view of structure: |
1770 1780 1790 1800 # 89|123456789|123456789|123456789|123456 $ 1768 UUUAAAUGGGCAAGCGGCACCGUCCGCCAAAACAAACGG=1806 % 1768 :::::::::::::((((::[[[[))))::::::::]]]]