Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CABYV

PKB-number: PKB44
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of cucurbit aphid-borne yellows virus
Organism: cucurbit aphid-borne yellows virus
Abbreviation: CABYV
RNA type: Viral Frameshift
Keywords: closterovirus; ribosomal frameshifting; RNA polymerase
EMBL number: X76931
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Guilley H. et al. Virology 1994, 202:1012-1017.
Stem sizes:
Loop sizes:
5 3
2 1 8
Position Paired:
1494-1498; 1505-1509
1501-1503; 1518-1520
Bracket view of structure:
                 1490      1500      1510      1520
     #      23456789|123456789|123456789|123456789|
     $ 1482 GGGAAACGGGCAGGCGGCGGCGACCGCCGAAACAACCGC=1520
     % 1482 ::::::::::::(((((::[[[:)))))::::::::]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-12 PKB00044.html